Skip to content Go to main menu
Close

SITEMAP

Research & Tech

gcCas9

(GeneCker’s CRISPR/Cas9 system)

  • Cas9 (CRISPR associated protein 9) : An RNA-guided DNA
    endonuclease discovered
    in microorganisms (Nobel Prize in Chemistry in 2020)
  • gcCas9 and
    guide RNA complex
  • Accurately recognizing
    and binding to the target DNA
  • Minimization of
    off-target DNA
    cleavage frequency

gcCas9

gcCas9 (CRISPR/Cas9 by GeneCker) is an enhanced version of conventional Cas9,
which enhances the detection limit of conventional NGS (Next-Generation Sequencing) with precise targeting down to the 1 bp (base pair) level of DNA.

Performance of gcCas9

Comparison of conventional (SpCas9) and gcCas9 (CRISPR/Cas9 by GeneCker)
Digenome sequencing result indicates the enhanced cleavage accuracy of gcCas9 compared to SpCas9.

Performance of gcCas9
Total detected site On-target site Off-target site
spCas9 696 1 695
gcCas9 1 1 -

A NEW PARADIGM in diagnostic platform
: overcoming the challenges of liquid biopsy by detecting low levels of mutant DNA

  • Target DNA sequence
    : ttggacatactggatacagc
  • Other CRISPR/Cas system
    : resulting in off-target
    DNA cleavage

A NEW PARADIGM

  • Enhanced diagnostic accuracy
    by reducing the off-target
    cleavage frequency with gcCas9
  • Enhanced diagnostic sensitivity
    with selective amplification
    of mutant DNA
  • Applicable to cancer
    diagnosis, prognosis,
    and monitoring

guide RNA / gcCas9 working process

  • Wild-type DNA & Mutant DNA
  • gcCas9 is attached to the Wild-type DNA
  • Wild-type DNA Cleavage
  • Mutant DNA is left before the amplification